View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_high_25 (Length: 253)
Name: NF1200_high_25
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 42442508 - 42442264
Alignment:
| Q |
1 |
gatggatagtaataaagttttgattttggatattagatcaccaactacaccggtcgcagaattggagagacattgcgctggtgttaatgctattgcttgg |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42442508 |
gatggatagtaataaagttgtgattttggatattagatcaccaactacaccggtcgcggaattggagagacatcgcgctggtgttaatgctattgcttgg |
42442409 |
T |
 |
| Q |
101 |
gctccaagaagttcaaagcatatttgttctggtggggatgatgcacaggctcttatttgggagttgccggctgtagctggtccgaatgggattgatccga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42442408 |
gctccaagaagttcaaagcatatttgttccggtggggatgatgcacaggctcttatttgggagttgccggctgtagctggtccgaatgggattgatccga |
42442309 |
T |
 |
| Q |
201 |
tgactatgtattctgctggttgtgaaattaatcagcttctgtggt |
245 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42442308 |
tgactacgtattctgctggttgtgaaattaatcagcttcagtggt |
42442264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 59 - 246
Target Start/End: Complemental strand, 42439098 - 42438911
Alignment:
| Q |
59 |
gaattggagagacattgcgctggtgttaatgctattgcttgggctccaagaagttcaaagcatatttgttctggtggggatgatgcacaggctcttattt |
158 |
Q |
| |
|
||||||||||||||| ||||| ||| |||| |||| ||||||||||||| ||| |||||||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
42439098 |
gaattggagagacatcacgctgatgtcaatgtgattgtttgggctccaagatgtttgaagcatatttgttcgggtggggatgatgcgcatgctcttattt |
42438999 |
T |
 |
| Q |
159 |
gggagttgccggctgtagctggtccgaatgggattgatccgatgactatgtattctgctggttgtgaaattaatcagcttctgtggtg |
246 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
42438998 |
gggagttgccggctgtggctggtccgaatgggattgatccaatgactatgaattctgcgggttgtgaaattaatcaacttcagtggtg |
42438911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University