View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_high_28 (Length: 218)
Name: NF1200_high_28
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 42442951 - 42443141
Alignment:
| Q |
13 |
gagatgaatgtgtggcgggatggaacatgagtttggttggtgggtaagggtgatcgaaggagagtgaaggttgaggtttgagtgagagggtatcggggtt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42442951 |
gagaagaatgtgtggcgggatggaacatgagtttggttggtgggtaagggtgatcgaaggagagtgaaggttgaggtttgagtgagagggtatcggggtt |
42443050 |
T |
|
| Q |
113 |
gaaattgaggatatcgatgcggtttgtgtattcttcgatgaagcttccgacggcgatacgttgttgtggggaatttgtgttgggagagatg |
203 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42443051 |
gaaattgagaatatcgatgcggtttgtgtattcttcgatgaagcttccgacggcgatacgttgttgtggggaatttgtgttgggagagatg |
42443141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 36 - 120
Target Start/End: Original strand, 17047406 - 17047489
Alignment:
| Q |
36 |
aacatgagtttggttggtgggtaagggtgatcgaaggagagtgaaggttgaggtttgagtgagagggtatcggggttgaaattga |
120 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17047406 |
aacatgagtttggtgggtgggtaaggatgatcgaaggagagtgaaggatgaggtttgagtgagagggtatc-tggttgaaattga |
17047489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University