View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_low_20 (Length: 334)
Name: NF1200_low_20
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 78 - 238
Target Start/End: Complemental strand, 54549746 - 54549586
Alignment:
| Q |
78 |
attattcttcattcaaatcataattgatgataattttttgggaaaaagggacaacatcagaattatagaggatgaaagagaaaactggttttactatctc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54549746 |
attattcttcattcaaatcataattgatgataattttttgggaaaaagggacaacatcagaattatagaggatgaaagagaaaactggttttactatctc |
54549647 |
T |
|
| Q |
178 |
ttaattggttttggaaacgtctttaagcgtctgtttagttgcacattgcacactcgaaatg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54549646 |
ttaattggttttggaaacgtctttaagcgtctgtttagttgcacattgcacactcgaaatg |
54549586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University