View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_low_22 (Length: 324)
Name: NF1200_low_22
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 87 - 176
Target Start/End: Complemental strand, 54986720 - 54986631
Alignment:
| Q |
87 |
ggcattgtttggctgaattggtgtgtggaagataatgatcgaagagacaataaccgagattctcttcatcgtgttccctatgctaaatgt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54986720 |
ggcattgtttggctgaattggtgtgtggaagataatgatcgaagagacaataaccgagattctcttcatcgtgttccctatgctaaatgt |
54986631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 100 - 176
Target Start/End: Complemental strand, 7884030 - 7883954
Alignment:
| Q |
100 |
tgaattggtgtgtggaagataatgatcgaagagacaataaccgagattctcttcatcgtgttccctatgctaaatgt |
176 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||| || || || ||||||||||| || || |||||||||||||| |
|
|
| T |
7884030 |
tgaagtggtgtgtgaaagataatgatggaagagactattacagaaattctcttcattgtatttcctatgctaaatgt |
7883954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University