View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_low_26 (Length: 296)
Name: NF1200_low_26
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 52 - 92
Target Start/End: Complemental strand, 23470799 - 23470759
Alignment:
| Q |
52 |
tagataatactagaaattctataaccacaattcttaaataa |
92 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23470799 |
tagaaaatactagaaattctataaccacaattcttaaataa |
23470759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University