View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_low_31 (Length: 269)
Name: NF1200_low_31
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 5297759 - 5298010
Alignment:
| Q |
10 |
aacaatatgtgcattccattttggcatgtttaccatctaacattttactgca-------------tggtaatctatagtttgattttgacaatttaccta |
96 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5297759 |
aacaaaatgtgcattccattttggcatgtttaccatctaacattttactgcatgcatatgatgcatggtaatctatagtttgattttgacaatttaccta |
5297858 |
T |
 |
| Q |
97 |
tcatagtaatttttatattatatctgttccaaaccgatcctcattgtttacttgttatgagaatttcactgttaaccctaatctaatcccnnnnnnngtt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5297859 |
tcatagtaatttttatattatatctgttccaaaccgatcctcattgtttacttgttatgagaatttcactgttaaccctaatctaatcccaaaaaaagtt |
5297958 |
T |
 |
| Q |
197 |
tggcaattggaaaataaattagtgtgtttgattctatcgtgacaaatattaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5297959 |
tggcaattggaaaataaattagtgtgtttgattctatcgtgacaaatattaa |
5298010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University