View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_low_33 (Length: 269)
Name: NF1200_low_33
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 34 - 178
Target Start/End: Original strand, 9080285 - 9080429
Alignment:
| Q |
34 |
ataccaaaaagaatcaaatatgagaatatatttttgacattgttgtttcggaaccctaagttctgaagatattttataacagttacattacatcaattat |
133 |
Q |
| |
|
||||| ||||||||| ||||| |||||||||||||||||||||||||| | |||||||| |||||||||||||||||| | |||||||||||||||| || |
|
|
| T |
9080285 |
ataccgaaaagaatcgaatataagaatatatttttgacattgttgtttagaaaccctaaattctgaagatattttatagcggttacattacatcaatcat |
9080384 |
T |
 |
| Q |
134 |
ttcataatttcgattaaaagaatctgaattcaaattctacctaaa |
178 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9080385 |
ttcataatttcgtttaaaagaatctgaattcaaattctacctaaa |
9080429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University