View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_low_34 (Length: 263)
Name: NF1200_low_34
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 151
Target Start/End: Complemental strand, 43852175 - 43852038
Alignment:
| Q |
14 |
aaatattgaactcgccacatttttcaaaccgtcccattaaacaatctgctaaaagccttatgtttagtcgtgccattggttttgcaccaaacggaacata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43852175 |
aaatattgaactcgccacatttttcaaaccgtcccattaaacaatctgctaaaagccttatgtttagtcgtgccattggttttgcaccaaacggaacata |
43852076 |
T |
|
| Q |
114 |
ttggcgtttgctacgtaaagtagcatcaactaaccttt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43852075 |
ttggcgtttgctacgtaaagtagcatcaactaaccttt |
43852038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University