View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_low_41 (Length: 208)
Name: NF1200_low_41
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 42453912 - 42454035
Alignment:
| Q |
1 |
tgtttggtttctttattttctaaggcatccaatgttccgttcaccttttcctccattttatgaaaattggattcgaaggatgccttcaaaattagatagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453912 |
tgtttggtttctttattttctaaggcatccaatgttccgttcaccttttcctccattttatgaaaattggattcgaaggatgccttcaaaattagatagc |
42454011 |
T |
|
| Q |
101 |
atgatatgaaaatgcagccctatg |
124 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
42454012 |
atgatatgaaaatgcagctctatg |
42454035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University