View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_low_42 (Length: 204)
Name: NF1200_low_42
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 25 - 177
Target Start/End: Original strand, 14805063 - 14805215
Alignment:
| Q |
25 |
atcaaatcatactttacatgacagtataatgaaatagttaaacgaaactataccaattttctcttttgagcagatatgcctcttagcttcaaatcaaaac |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14805063 |
atcaaatcatactttacatgacagtataatgaaatagttaaacgaaactataccaattttctcttttgagcagatatgcctcttagcttcaaatcaaaac |
14805162 |
T |
|
| Q |
125 |
atatggttgttcttttgttgttacatctgctatgaaaagttggatattattcg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14805163 |
atatggttgttcttttgttgttacatctgctatgaaaagttggatattcttcg |
14805215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University