View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12011_high_15 (Length: 285)

Name: NF12011_high_15
Description: NF12011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12011_high_15
NF12011_high_15
[»] chr3 (1 HSPs)
chr3 (186-270)||(29594462-29594546)
[»] chr4 (4 HSPs)
chr4 (186-270)||(52077355-52077439)
chr4 (186-270)||(29058832-29058916)
chr4 (105-189)||(29059084-29059168)
chr4 (104-189)||(52077102-52077187)
[»] chr1 (1 HSPs)
chr1 (218-269)||(51288742-51288793)


Alignment Details
Target: chr3 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 29594462 - 29594546
Alignment:
186 attcttcttgtcattctccagtaatttggcgtgaaggttatctgatatgtgtataagttttgcaagagcttctgatgataaaaat 270  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
29594462 attcttcttgccattctccagtaatttggcgtgaaggttatctgatatgtgtataagttttgcaagagcttctaatgataaaaat 29594546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 52077355 - 52077439
Alignment:
186 attcttcttgtcattctccagtaatttggcgtgaaggttatctgatatgtgtataagttttgcaagagcttctgatgataaaaat 270  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||    
52077355 attcttcttgccattctccactaatttggcgtgaaggttatctgatatgggtataagttttgcaagagcttctaatgataaaaat 52077439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 186 - 270
Target Start/End: Complemental strand, 29058916 - 29058832
Alignment:
186 attcttcttgtcattctccagtaatttggcgtgaaggttatctgatatgtgtataagttttgcaagagcttctgatgataaaaat 270  Q
    |||||||||| |||||||||||||||||  ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||    
29058916 attcttcttgccattctccagtaatttgaagtgaaggttatctgatatgggtataagttttgcaagagcttctaatgataaaaat 29058832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 105 - 189
Target Start/End: Complemental strand, 29059168 - 29059084
Alignment:
105 gtgaagtttagcatgggaaagaagggttgttttttatgatgggaaagttgatgttacaatcatagatatatcatttaatttattc 189  Q
    ||||||||||||||  ||||| || |||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||    
29059168 gtgaagtttagcatatgaaaggagcgttgttttctattatgggaaagttgatgttacaaccatagatatatcatttaatttattc 29059084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 104 - 189
Target Start/End: Original strand, 52077102 - 52077187
Alignment:
104 ggtgaagtttagcatgggaaagaagggttgttttttatgatgggaaagttgatgttacaatcatagatatatcatttaatttattc 189  Q
    |||| |||||| |||||||||| || ||| |||   |||||||||||||||||||||||| |||||||||||||||||||||||||    
52077102 ggtggagtttaacatgggaaaggagagttatttcccatgatgggaaagttgatgttacaaccatagatatatcatttaatttattc 52077187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 218 - 269
Target Start/End: Complemental strand, 51288793 - 51288742
Alignment:
218 gaaggttatctgatatgtgtataagttttgcaagagcttctgatgataaaaa 269  Q
    ||||||||||||||||| |||||| ||||||||||||| || ||||||||||    
51288793 gaaggttatctgatatgggtataaattttgcaagagctcctaatgataaaaa 51288742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University