View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12011_high_21 (Length: 241)
Name: NF12011_high_21
Description: NF12011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12011_high_21 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 59 - 241
Target Start/End: Original strand, 27124834 - 27125016
Alignment:
| Q |
59 |
tatagatttgtaaccttttgaaaggcttgaaacaagtactagtatcgtttcttcttcatcaggtcctggtagatgtgttacagggttattcggtccagga |
158 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27124834 |
tatagatttgtaaccttttaaaaggcttgaaacaagtactagtatcgtttcttcttcatcaggtcctggtagatgtgttacagggttattcggtccaggt |
27124933 |
T |
|
| Q |
159 |
ggaaaacttatccgtggcttttggattgggtaatccataatcgagggttgagttccttctactgggctgcaggcgtattctct |
241 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| ||||||||||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
27124934 |
ggaaaacttatccgtggcttctgcattgggtaatccagaatcgagggttgagttcctgctactgggctgcatgcatattctct |
27125016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University