View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12011_high_22 (Length: 238)
Name: NF12011_high_22
Description: NF12011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12011_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 16131165 - 16131387
Alignment:
| Q |
1 |
taaaccagattagtctctcaatttccacattaaggaagttgaccatcagttatcttatgctttgtgtagattatgatcatattatgaaactcaagattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16131165 |
taaaccagattagtctctcaatttccacattaaggaagttgaccatcagttatcttatgctttgtgtagattatgatcatattatgaaactcaagattga |
16131264 |
T |
|
| Q |
101 |
tgctgtgaatcttctatctttatactgcatatgcaatccagtaatagaagttatccctgttgacctgacctccctagttgatgcgttcatttttcttggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16131265 |
tgctgtgaatcttctatctttatactgcatatgcaatccaataatagaagttatccctgttaacctgacctccctagttgatgcgttcatttttcttggg |
16131364 |
T |
|
| Q |
201 |
tatgtctatccacatgatgaacc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
16131365 |
tatgtctatccacatgatgaacc |
16131387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 71 - 184
Target Start/End: Complemental strand, 31268523 - 31268410
Alignment:
| Q |
71 |
ttatgatcatattatgaaactcaagattgatgctgtgaatcttctatctttatactgcatatgcaatccagtaatagaagttatccctgttgacctgacc |
170 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| |||||| |||| ||| |||| |||||||||| ||||||| ||||||||||| |||| ||| |
|
|
| T |
31268523 |
ttatgatcatgatatgaaactgcagattgatgctgttaatcttttatcgttaagttgcagatgcaatccaacaatagaatttatccctgttaaccttacc |
31268424 |
T |
|
| Q |
171 |
tccctagttgatgc |
184 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
31268423 |
tccgtagttgatgc |
31268410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University