View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12011_low_17 (Length: 278)
Name: NF12011_low_17
Description: NF12011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12011_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 15 - 270
Target Start/End: Original strand, 2156909 - 2157163
Alignment:
| Q |
15 |
atcattacacacatgaaggagtagccgtatgagatgaaagggcttcttataattttttgcgtgacgtcttccttacaaccaacttccctcaaagaataac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
2156909 |
atcattacacacatgaaggagtagccgtatgagatgaaagggcttcttataattttttgcgtgacgtcttcattagaaccaacttccctcaaa--ataac |
2157006 |
T |
 |
| Q |
115 |
tcacataggcgtgcgtggcattcttcaacataatttt-ttgtgtcagtgtttgtagtttggaggaatcggtggaagatctgtttttatcttctcattttg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2157007 |
tcacataggcgtgcgtggcattcttcaacataatttttttgtgtcagtgtttgtagtttggaggaatcggtggaagatctgtttttatcttctcattttg |
2157106 |
T |
 |
| Q |
214 |
gttctatttggcaacttcttcaatgatggattggtacatcggcggttgatcctctct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2157107 |
gttctatttggcaacttcttcaatgatggattggtacatcggcggttgatcctctct |
2157163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University