View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12011_low_20 (Length: 262)
Name: NF12011_low_20
Description: NF12011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12011_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 37640295 - 37640543
Alignment:
| Q |
1 |
gcccaaaccatcgccggctacgatcgtttcccatgggacgcgattcttctccaaaccaactcagctttgatgaacaacaccgatcctaacgtatgggcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37640295 |
gcccaaaccatcgccggctacgatcgtttcccatgggacgcgattcttctccaaaccaactcagctttgatgaacaacaccgatcctaacgtatgggcgt |
37640394 |
T |
|
| Q |
101 |
cgcaaatcatctcaacactccgctctaccgccgtcactctcccttccgtcgacctcgctcaccgtttagtctctcatttgttctggaaccatcactctcc |
200 |
Q |
| |
|
|||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37640395 |
cgcaaatcatctcaacactccgttccaccgctgtcactctcccttccgtcgacctcgctcaccgtttagtctctcatttgttctggaaccatcactctcc |
37640494 |
T |
|
| Q |
201 |
catcgcttggaagcttctagacattgctacttcactcaaccttcttcct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37640495 |
catcgcttggaagcttctagacattgctgcttcactcaaccttcttcct |
37640543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 20 - 249
Target Start/End: Complemental strand, 2157028 - 2156797
Alignment:
| Q |
20 |
acgatcgtttcccatgggacgcgattcttctccaaaccaactcagctttgatgaacaacac--cgatcctaacgtatgggcgtcgcaaatcatctcaaca |
117 |
Q |
| |
|
|||||||||| |||||||||| |||||||| ||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||| || | | |
|
|
| T |
2157028 |
acgatcgttttccatgggacgtgattcttcgccaaaccaactcagctttgctgaacaacacacctgtcctaacgtatgggcgtcgcaaatcacttccata |
2156929 |
T |
|
| Q |
118 |
ctccgctctaccgccgtcactctcccttccgtcgacctcgctcaccgtttagtctctcatttgttctggaaccatcactctcccatcgcttggaagcttc |
217 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
2156928 |
ctccgttcctccgccgtcactctcccttccgtcgacctcgctctccgtttagtctctcatttgttttggaaccatcactctcccaccgtttggaagcttc |
2156829 |
T |
|
| Q |
218 |
tagacattgctacttcactcaaccttcttcct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2156828 |
tagacattgctacttcactcaaccttcttcct |
2156797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University