View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12011_low_24 (Length: 235)
Name: NF12011_low_24
Description: NF12011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12011_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 32275231 - 32275429
Alignment:
| Q |
11 |
gaagcaaaggtcatacgtttcagaaacagaaaacaataacttgaaggaataaacaaaattttgtctaagatctctatcaactgatttccacgacaacaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32275231 |
gaagcaaaggtcatacgtttcagaaacagaaaacaataacttgaaggaataaacaaaattttgtctaacatctctatcaactgatttccacgacaacaag |
32275330 |
T |
|
| Q |
111 |
gttaaatgtggaccacaaatgcaagtgggaacacttttagcaagagtagttatgatatgtttaccaaaaatgacattaaacttgaggaatcaaatatagg |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32275331 |
gttaaatgtggaccacaaatgcaagtg------------gcaagagtagttatgatatgtttaccaaaaatgacattaaacttgaggaatcaaatatagg |
32275418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University