View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12011_low_8 (Length: 373)
Name: NF12011_low_8
Description: NF12011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12011_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 144 - 322
Target Start/End: Complemental strand, 8400102 - 8399925
Alignment:
| Q |
144 |
taatatatagttaggtgatgtgtggacaagatgagaatgggtcagataaggaaagtgttgactgggtttgggtggtacaagttgacttttatttgtttgt |
243 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8400102 |
taatatatagt-aggtgatgtgtggacaagatgagaatgggtcagataaggaaagtgttgactgggtatgggtggtacaagttgacttttatttgtttgt |
8400004 |
T |
 |
| Q |
244 |
ttgatttttcattaaattcaactcttaaaactgttcaaagttcaaacattttcatcccatactcggatctacactatga |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8400003 |
ttgatttttcattaaattcaactcttaaaactgttcaaagttcaaacattttcatcccatactcggatctacactatga |
8399925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 9 - 63
Target Start/End: Complemental strand, 8400238 - 8400184
Alignment:
| Q |
9 |
agcagagatgaaacttgtaaagaagccatgtgatatatgacgagaagttagataa |
63 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8400238 |
agcatagatgaaacttgtaaagaagccatgtgatatatgatgagaagttagataa |
8400184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 321 - 358
Target Start/End: Complemental strand, 8399905 - 8399868
Alignment:
| Q |
321 |
gagataaaagggatttcctttctcgtggtaggtatttc |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8399905 |
gagataaaagggatttcctttctcgtggtaggtatttc |
8399868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University