View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12015_low_12 (Length: 352)
Name: NF12015_low_12
Description: NF12015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12015_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 30907646 - 30907311
Alignment:
| Q |
1 |
ggtcgcgtgtgcagttgaggtacacgatggtgttggagctagtgatgttgaacggaagagtgttgttgagtatgataccttcatatattttatctgtggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30907646 |
ggtcgcgtgtgcagttgaggtacacgatggtattggagctagtgatgttgaacggaagagtgttgttgagtatgataccttcatatattttatctgtggt |
30907547 |
T |
 |
| Q |
101 |
ggtgcatgtgttagggatgagtggtgctggttgtattacgaagcgttgggtttgagggtttatggattggattgggtaggagttgtttactgtggtgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30907546 |
ggtgcatgtgttagggatgagtggtgctggttgtattacgaagcgttgggtttgagggtttatggattggattgggtaggagttgtttactgtggtgaaa |
30907447 |
T |
 |
| Q |
201 |
actaatgttccggtggaggtgcagttgattttgtatgattggtcaccgcaggttggggtggtgctgagtgggaaagggacggtggtgttgccgcagggtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30907446 |
actaatgttccggtggaggtgcagtttattttgtatgattggtcaccgcaggttggggtggtgctgagcgggaaagggacggtggtgttgccgcagggtg |
30907347 |
T |
 |
| Q |
301 |
gacatggtgtggcggagaagacatgggtggtgcatg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30907346 |
gacatggtgtggcggagaagacatgggtggtgcatg |
30907311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University