View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_high_27 (Length: 340)
Name: NF12018_high_27
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 167 - 324
Target Start/End: Complemental strand, 40935996 - 40935838
Alignment:
| Q |
167 |
aaagaagtggtcaggttggtatgttaatcgactagatatataataattaattagatgagtaaaaatattaggtaagggatttcaacttcttaaatggtgg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40935996 |
aaagaagtggtcaggttggtatgttaatcgactagatatataataattaattagatgagtaaaaatattaggtaagggatttcaacttcttaaatggtgg |
40935897 |
T |
|
| Q |
267 |
-nnnnnnnnntcggttgaaggagaaaatcaactttaacaagatttggcgacataatact |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40935896 |
aaaaaaaaaatcggttgaaggagaaaatcaactttaacaagatttggcgacataatact |
40935838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University