View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_high_28 (Length: 325)
Name: NF12018_high_28
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 2624967 - 2625275
Alignment:
| Q |
1 |
aaaacccccctcggagcagttgcgctgatattaacattattttgcaaaagaggtgaaatattatagcaactgggaatgtttgttgccatagaatgtcagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624967 |
aaaacccccctcggagcagttgcgctgatattaacattattttgcaa--gaggtgaaatattatagcaactgggaatgtttgttgccatagaatgtcagc |
2625064 |
T |
 |
| Q |
101 |
aaaggacaatatcctaacaacaataccattggatagcagcttgacttaagtttggatgactactcattggaatttgcatcatgcaaatttgggttttgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2625065 |
aaaggacaatatcctaacaacaataccattggatagcagcttgacttaagtttggatgactactcgttggaatttgcatcatgcaaatttgggttttgat |
2625164 |
T |
 |
| Q |
201 |
taattattgagctttcagtgtagatcgtataagcactgaagaactttccagtagattagttgagtttggattgattggttccatttgaatatttgatgta |
300 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625165 |
taattattgagctttcagtggagatcatataagcagtgaagaactttccagtagattagttgagtttggattgattggttccatttgaatatttgatgta |
2625264 |
T |
 |
| Q |
301 |
ataccaatgtg |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
2625265 |
ataccaatgtg |
2625275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University