View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_high_38 (Length: 248)
Name: NF12018_high_38
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_high_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 6e-58; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 114 - 231
Target Start/End: Original strand, 30017718 - 30017835
Alignment:
| Q |
114 |
attttgcttgcacttcaagaaaacatgaaattaccgggcatgtttatcagcagccgaaaatccacagaagacttcgacagtttttatgtcatccgcggca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30017718 |
attttgcttgcacttcaagaaaacatgaaattaccgggcatgtttatcagcagccgaaaatccacagaagacttcgacagtttttatgtcatccgcggca |
30017817 |
T |
|
| Q |
214 |
accaaaacagccaaaatg |
231 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
30017818 |
accaaaacagccgaaatg |
30017835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 50 - 118
Target Start/End: Original strand, 30017440 - 30017508
Alignment:
| Q |
50 |
tgttgaggttggaggagtgcttatgcggttacattttgtgttatcgtgtattgtagtgagtttcatttt |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30017440 |
tgttgaggttggaggaatgcttatgcggttacattttgtgttatcgtgtattgtagtgagtttcatttt |
30017508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 30017378 - 30017411
Alignment:
| Q |
1 |
cccagatgtttcacggatgtagtacaaccgtttg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30017378 |
cccagatgtttcacggatgtagtacaaccgtttg |
30017411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University