View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_high_42 (Length: 220)
Name: NF12018_high_42
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 116 - 200
Target Start/End: Complemental strand, 2624859 - 2624775
Alignment:
| Q |
116 |
ctagtttataaatttttagcattgacaccttcaattgaaggcatgccaagtgtagggcacgtgtcaatgtccaacacctacacag |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2624859 |
ctagtttataaatatttagcattgacaccttcaattgaaggcatgccaagtgtcgggcacgtgtcaatgtccaacacctacacag |
2624775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 2624921 - 2624860
Alignment:
| Q |
1 |
tcaataacattgagcacaaagaacaccagatgggggcctgcagttgaatgttcaacagtgag |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2624921 |
tcaataacattgagcacaaagaacaccagatgggggcctgcaattgaatgttcaacagtgag |
2624860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University