View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_high_43 (Length: 218)
Name: NF12018_high_43
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_high_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 89 - 212
Target Start/End: Complemental strand, 3872177 - 3872054
Alignment:
| Q |
89 |
gagagaatacggaaaatttctctataaaagtgtggagaatgaagagatattttannnnnnngtcgctaattaaatttatattttcaagtcatgtttagtt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3872177 |
gagagaatacggaaaatttctctataaaagtgtggataatgaagagatattttatttttttgtcgctaattaaatttatattttcaagtcatgtttagtt |
3872078 |
T |
|
| Q |
189 |
taatgtctctaatggatcctttgc |
212 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3872077 |
taatgtctctaatggatcctttgc |
3872054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University