View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_low_14 (Length: 432)
Name: NF12018_low_14
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 12229765 - 12229576
Alignment:
| Q |
1 |
atttttggcggaaatggttacaacggtgggaacattggagggtttcgggaagatcaagtaatcttggtaagagatgattcttcgaaggaagaaatcatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12229765 |
atttttggcggaaatggttacaacggtgggaacattggagggtttcgggaagatcaagtaatattggtaagagatgattcttcgaaggaagaaatcatgc |
12229666 |
T |
|
| Q |
101 |
accttgttgggaaacaagctcttgttttgacgattttagagtgcaaaggccttcaatttaaggtttttacaactctcgattatgcttaac |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12229665 |
accttgttgggaaacaagctcttgttttgacgattttagagtgcaaaggccttcaatttaaggtttttacaactctcgattatgcttaac |
12229576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 258 - 413
Target Start/End: Complemental strand, 12229506 - 12229354
Alignment:
| Q |
258 |
aggatgtgttattgtacaacttttttgcatcttctcctttggaaaggcgatggaggattatatacgagtacatgaaagaaaagaatctgttggaccctcg |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12229506 |
aggatgtgttattgtacaacttttttgcatcttctcctttggaaaggcgatgggggattatataccagtacatgaaagaaaagaatctgttggaccctcg |
12229407 |
T |
|
| Q |
358 |
atcgcgtattaactgccaaagttttgtcgattcaaagcataatgttttgtgctctg |
413 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12229406 |
atcgcg---taactgccaaagttttgtcgattcaaagcataatgttttgtgctctg |
12229354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University