View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_low_24 (Length: 353)
Name: NF12018_low_24
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 8 - 345
Target Start/End: Original strand, 915887 - 916224
Alignment:
| Q |
8 |
atacatacatacaagaggacaaaatgaaaaagcatagccacaaaaaaggtaattaaacatttatttcaaccataccaaaaacggagtgatggtgtgtcct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
915887 |
atacatacatacaagaggacaaaatgaaaaagcataaccacaaaaaaggtaattaaacatttatttcaaccataccaaaaacggagtgatggtgtgtcct |
915986 |
T |
|
| Q |
108 |
attccaacctttccaatctcctctgttttttattcaccacctacttgggaagttgaagttgacctcgtactgtgtttgtttgatgaagacaactcagttg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
915987 |
attccaacctttccaatctcctctgttttttattcaccacctacttgggaagtggaagttgacctcgtactgtgtttgtttgatgaagacaactcagttg |
916086 |
T |
|
| Q |
208 |
accttctcctgagtatctgtctcataccatcagcaacacaaactgcaggatttgatttaatcttgcgacagaacaacatgtgagcttttattgcttcttc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
916087 |
accttctcctgagtatctgtctcataccatcagcaacacaaactgcaggatttgatttaatcttacgacagaacaacatgtgagcttttattgcttcttc |
916186 |
T |
|
| Q |
308 |
cattgcaaatgtctttttccctctaatagcttcatctc |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
916187 |
cattgcaaatgtctttttccctctaatagcttcatctc |
916224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University