View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12018_low_27 (Length: 342)

Name: NF12018_low_27
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12018_low_27
NF12018_low_27
[»] chr1 (2 HSPs)
chr1 (53-330)||(52708993-52709270)
chr1 (1-34)||(52708941-52708974)


Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 53 - 330
Target Start/End: Original strand, 52708993 - 52709270
Alignment:
53 atgtttgtgaaacttttatgaaaacggcacatcttttgttcaggatagaactgctctgctattcctgctttttccagcagcacttctcattctaagatct 152  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52708993 atgtttgtgaaacttttatgaaaatggcacatcttttgttcaggatagaactgctctgctattcctgctttttccagcagcacttctcattctaagatct 52709092  T
153 tgggtttgggagggatgtttgccagcttttccagtacagatttaccaggtactttctttttaacgactcttgcttcatgtcatgttagtttttacttgct 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
52709093 tgggtttgggagggatgtttgccagcttttccagtacagatttaccaggtactttctttttaaccactcttgcttcatgtcatgttagtttttacttgct 52709192  T
253 tacatcaaatatttgtctgcaatctgtcattgagcgtcatcatttctcaggcatggctgttatttctttacacaggtt 330  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||    
52709193 tacatcaaatatttgtctgcaatctgtcattgagcgtcatcatttctcaggcatggctgctatttctttacactggtt 52709270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 52708941 - 52708974
Alignment:
1 atatcccacaccttattgctgatgcccatccgcg 34  Q
    ||||||||||||||||||||||||||||||||||    
52708941 atatcccacaccttattgctgatgcccatccgcg 52708974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University