View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_low_27 (Length: 342)
Name: NF12018_low_27
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 53 - 330
Target Start/End: Original strand, 52708993 - 52709270
Alignment:
| Q |
53 |
atgtttgtgaaacttttatgaaaacggcacatcttttgttcaggatagaactgctctgctattcctgctttttccagcagcacttctcattctaagatct |
152 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52708993 |
atgtttgtgaaacttttatgaaaatggcacatcttttgttcaggatagaactgctctgctattcctgctttttccagcagcacttctcattctaagatct |
52709092 |
T |
 |
| Q |
153 |
tgggtttgggagggatgtttgccagcttttccagtacagatttaccaggtactttctttttaacgactcttgcttcatgtcatgttagtttttacttgct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52709093 |
tgggtttgggagggatgtttgccagcttttccagtacagatttaccaggtactttctttttaaccactcttgcttcatgtcatgttagtttttacttgct |
52709192 |
T |
 |
| Q |
253 |
tacatcaaatatttgtctgcaatctgtcattgagcgtcatcatttctcaggcatggctgttatttctttacacaggtt |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
52709193 |
tacatcaaatatttgtctgcaatctgtcattgagcgtcatcatttctcaggcatggctgctatttctttacactggtt |
52709270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 52708941 - 52708974
Alignment:
| Q |
1 |
atatcccacaccttattgctgatgcccatccgcg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52708941 |
atatcccacaccttattgctgatgcccatccgcg |
52708974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University