View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_low_33 (Length: 305)
Name: NF12018_low_33
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 31 - 292
Target Start/End: Original strand, 52708709 - 52708970
Alignment:
| Q |
31 |
actgttaggggttgctggctgctatacatactaaatgcatgttagtcaaccataattacctaaaatttaagttattattattattaatcaaactggaagg |
130 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
52708709 |
actgttagtggttgctggctgctatacatactaaatgcatgttagtcaaccataattacctaaaatttaagttattattattattaatcaaacttgaatg |
52708808 |
T |
 |
| Q |
131 |
ttacatagatctaacacctagttaaaaagtcaatgacaacaactacatgcctaggcatgagttgaatcaagtgaacttggcctatttctcgaattcacca |
230 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52708809 |
ttacatagatctaacacctagttaaagagtcaataacaacaactacatgcctaggcatgagtggaatcaagggaacttggcctatttctcgaattcacca |
52708908 |
T |
 |
| Q |
231 |
tcagtgacataacatgtcgcagtaacaccgcaatatcccacaccttattgctgatgtccatc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52708909 |
tcagtgacataacatgtcgcagtaacaccgcaatatcccacaccttattgctgatgcccatc |
52708970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University