View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_low_36 (Length: 280)
Name: NF12018_low_36
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 99 - 266
Target Start/End: Complemental strand, 915809 - 915631
Alignment:
| Q |
99 |
ggcaacagaagtgaatcccaattttattctgcatgaaaatgatcaataaccattctctctcaaaacttagtcattcaacacacaaacacttctaattttg |
198 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
915809 |
ggcaacagaagtgaatcccaattatattctgcatgaaaatgatcaataaccattctctctcaaaacttagtcattcaacacacaaacacttctgattttg |
915710 |
T |
 |
| Q |
199 |
ggttatcttctact----------tgttatctt-acaacagtaccctctacaaatgattcacatggatacaaaatactg |
266 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
915709 |
ggttatcttctactttgttttccatgttatcttaacaacagtaccctctccaaatgattcacatggatacaaaatactg |
915631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University