View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_low_38 (Length: 262)
Name: NF12018_low_38
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 104 - 249
Target Start/End: Complemental strand, 7087260 - 7087115
Alignment:
| Q |
104 |
aggttgaaggaacttcctttgagtttccaaatgggactttggtgttagttttgatgttgatatttcctcatctagttttgtttttgtgtgcttagaaaga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7087260 |
aggttgaaggaacttcctttgagtttccaaatgggactttggtgttagttttgatgttgatatttcctcatctagttttgtttttgtgtgcttagaaaga |
7087161 |
T |
|
| Q |
204 |
ttctctggttgtgacacggggatgattttcgatggtgacttcgtct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7087160 |
ttctctggttgtgacacggggatgattttcgatggtgacttcgtct |
7087115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 104 - 245
Target Start/End: Complemental strand, 7667031 - 7666889
Alignment:
| Q |
104 |
aggttgaagg-aacttcctttgagtttccaaatgggactttggtgttagttttgatgttgatatttcctcatctagttttgtttttgtgtgcttagaaag |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| ||||| |||| | |||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
7667031 |
aggttgaaggtaacttcctttgagtttccaaaggggactttgatgttattttttagattgatatttcctcatctaattttgtctttgtgtgcttagaaag |
7666932 |
T |
|
| Q |
203 |
attctctggttgtgacacggggatgattttcgatggtgacttc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
7666931 |
attctctggttgtgacacggggatgattttcgacggagacttc |
7666889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University