View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12018_low_45 (Length: 205)
Name: NF12018_low_45
Description: NF12018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12018_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 46223597 - 46223420
Alignment:
| Q |
18 |
agtttcccattacgcgcacaatgtctagcccaagaaaccaaatttgctcgcttaaactccgaaatatgcttgaatccatccccacc------accaccgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| | |||||||| |
|
|
| T |
46223597 |
agtttcccattacgcgcacaatgtctagcccaagaaaccaaattcgctcgcttaaactctgaaatatgcttgaatccatccccatccccactaccaccgg |
46223498 |
T |
 |
| Q |
112 |
cattcacttgaagaggtcttctcccagaaacaataacaagtaataacacaccaaaactataaacatcagacttctctg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46223497 |
cattcacttgaagaggtcttctcccagaaacaataacaagtaataacacaccaaaactataaacatcagacttctctg |
46223420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University