View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12019_low_21 (Length: 238)
Name: NF12019_low_21
Description: NF12019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12019_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 50467189 - 50467416
Alignment:
| Q |
1 |
taatttcccacttgcactgttttgttgtcccattcttatgagaaaaatattgtttcttttttgtttt-aagtcttacatatattttgttagttcagcaga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50467189 |
taatttcccacttgcactgttttgttgtcccattcttatgagaaaaatattgttttttttttttttttaagtcttacatatattttgttagttcagcaga |
50467288 |
T |
|
| Q |
100 |
aagataaataaaatctgataaataattattttgacggaatttgaatcccgaatctctcaaataaaataatcatatgaaaaaattattgatgaaaatgttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50467289 |
aagataaataaaatctgataaataattattttgacgaaatttgaatcccgaatctctcaaataaaataatcatatgagaaaattattgatgaaaatgttt |
50467388 |
T |
|
| Q |
200 |
ttctatcatatataaatttacacaggtt |
227 |
Q |
| |
|
|||||| || |||||||||||||||||| |
|
|
| T |
50467389 |
ttctattatgtataaatttacacaggtt |
50467416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University