View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12019_low_22 (Length: 233)
Name: NF12019_low_22
Description: NF12019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12019_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 26488354 - 26488139
Alignment:
| Q |
1 |
gaaaaaatgagtgagataatatagagactggtaacggctagttgcaacggctttaagaattttgcgagggaatttccgaggaaaaactcctggcaaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26488354 |
gaaaaaatgagtgagataatatagagactggtaacggctagttgcaacggctttaagaattttgcgagggaatttccgaggaaaaactcctggcaaactt |
26488255 |
T |
|
| Q |
101 |
tgaaaagaatctcataaacttttttcctaataaatggccttggattatgtgccaactttctttcttcaaaccagcatggacagtaatcaacttgtagcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26488254 |
tgaaaagaatctcataaacttttttcctaataaatggccttggattatgtgccaactttctttcttcaaaccagcatggacagtaatcaacttgtagcac |
26488155 |
T |
|
| Q |
201 |
ttaaactccatcatcc |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
26488154 |
ttaaactccatcatcc |
26488139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University