View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12021_high_16 (Length: 304)
Name: NF12021_high_16
Description: NF12021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12021_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 29733298 - 29733588
Alignment:
| Q |
1 |
tttgtttcgacgagtgtgactctaaattataactattgtcgacaatttcgtttggtgtgtaaggctactttttatttatgtgtgaagtacacaagctttg |
100 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29733298 |
tttgtttcgacgtgtgtgactctgaattataactgttgtcgataatttcgtttggtgtgtaaggctactttttatttatgtgtgaagtacacaatctttg |
29733397 |
T |
 |
| Q |
101 |
tctttatttattgctgctttaaatttttt-gcagcaacaccaatataccttttaggttaataccttaatattttggaaaaaagaagtgatattaaattct |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29733398 |
tctttatttattgcccctttaaatttttttgcagcaacaccaatataccttttaggttaataccttaatattttggaaaa-agaagtgatattaaattct |
29733496 |
T |
 |
| Q |
200 |
ctctggatcttgctcttaacttaatgtgatgatatttcggactcttcaagacgaaacatcaagctcgttaaccaaaaccatgacccatgtga |
291 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
29733497 |
ctctgtatcttgctcttaacttaatgtgatgatatttcggactcttcaagacgaaacatcaagctcgttaaccacaaccatgatccatgtga |
29733588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University