View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12021_high_20 (Length: 213)
Name: NF12021_high_20
Description: NF12021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12021_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 24634050 - 24633875
Alignment:
| Q |
18 |
aaccatggcaagctcgtcctagattgggctatgcagataaactttttgtggttctattcaagttacgcatgccttgattccatgtgtcttgtacgaacga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24634050 |
aaccatggcaagctcgtcctagattgggctatgcagataaactttttgtggtcctattcaagttacgcatgccttgattcgatgtgtcttgtacgaacga |
24633951 |
T |
 |
| Q |
118 |
tcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcacacacgacggt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24633950 |
tcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcacacgcgacggt |
24633875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 23792525 - 23792690
Alignment:
| Q |
18 |
aaccatggcaagctcgtcctagattgggctatgcagataaactttttgtggttctattcaagttacgcatgccttgattccatgtgtcttgtacgaacga |
117 |
Q |
| |
|
||||||| ||||| ||||| | | ||| |||||||||||||||| ||||| | |||||| ||||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
23792525 |
aaccatgccaagcccgtcccaaaatggactatgcagataaacttgttgtgttcacattcaaattacgcatgccctgattccacgtgtcttgtacggacga |
23792624 |
T |
 |
| Q |
118 |
tcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcaca |
184 |
Q |
| |
|
|||||||||| || | || |||||||||||||||||| ||||||||||| | ||||||| |||||| |
|
|
| T |
23792625 |
ccaacgtctctgaaagagcatctcaatttcacgtgccc-gtatggacgagtttcaacctacttcaca |
23792690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 172
Target Start/End: Original strand, 22876321 - 22876418
Alignment:
| Q |
75 |
tcaagttacgcatgccttgattccatgtgtcttgtacgaacgatcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgca |
172 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||||||| ||||||| ||||| || ||||||||| |||||| || |||| ||||||| |||| |
|
|
| T |
22876321 |
tcaagttacacatgctctgattccacgtgtcttgtacgaatgatcaacatctctaaaaacgcgtctcaacttcacgcaccttgtacggacgagttgca |
22876418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 84 - 183
Target Start/End: Original strand, 26568367 - 26568466
Alignment:
| Q |
84 |
gcatgccttgattccatgtgtcttgtacgaacgatcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcac |
183 |
Q |
| |
|
|||||| |||||| || |||||||||| |||||||||||||| | || | |||||| || ||||| || ||||||||||||| |||| ||||| |||| |
|
|
| T |
26568367 |
gcatgctttgatttcacatgtcttgtacaaacgatcaacgtctttgaaagcgcgtcttaacttcacatgttctgtatggacgagttgcagcctagatcac |
26568466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 190
Target Start/End: Original strand, 11801109 - 11801189
Alignment:
| Q |
110 |
acgaacgatcaacgtctcttaatgtgcgtctcaatttcacgtgccctgtatggacgaggtgcaacctagttcacacacgac |
190 |
Q |
| |
|
||||| ||||||||||||| || | || |||||| | |||| |||| ||| ||||||| |||| |||||| |||||||||| |
|
|
| T |
11801109 |
acgaatgatcaacgtctctgaaagcgcatctcaactccacgcgcccagtacggacgagttgcaccctagtccacacacgac |
11801189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University