View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12021_high_21 (Length: 207)

Name: NF12021_high_21
Description: NF12021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12021_high_21
NF12021_high_21
[»] chr2 (2 HSPs)
chr2 (155-188)||(13023993-13024026)
chr2 (18-50)||(13023855-13023887)


Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 188
Target Start/End: Original strand, 13023993 - 13024026
Alignment:
155 cttaaaccataagtttcttgtatttgattagagt 188  Q
    ||||||||||||||||||||||||||||||||||    
13023993 cttaaaccataagtttcttgtatttgattagagt 13024026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 13023855 - 13023887
Alignment:
18 atgaacgagggagaagcacgatttcgatataac 50  Q
    |||||||||||||||||||||||||||||||||    
13023855 atgaacgagggagaagcacgatttcgatataac 13023887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University