View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12021_low_18 (Length: 248)
Name: NF12021_low_18
Description: NF12021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12021_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 42125909 - 42125670
Alignment:
| Q |
1 |
gttagttcccttgctgcagctattacttacttcatgtatacatggttcttccaaaaacctgcttcaatccaaagcttttcatttgtttgcatatgtggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125909 |
gttagttcccttgctgcagctattacttacttcatgtatacatggttcttccaaaaacctgcttcaatccaaagcttttcatttgtttgcatatgtggtg |
42125810 |
T |
|
| Q |
101 |
cctttcattggattccattcactattactgcatatgctaccatgttttctgaagttcaatcaaatcccattgcctttgccatttcatttacatgtgctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42125809 |
cctttcattggattccattcactattactgcatatgctaccatgttttctgaagttcaatcaaatcccattgcctttgccatttcatttacatgtgctta |
42125710 |
T |
|
| Q |
201 |
cttgcttcatggtctcatactcacctctctcacaggttct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42125709 |
cttgcttcatggtctcatactcacctctctcacatgttct |
42125670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 75 - 233
Target Start/End: Complemental strand, 24929134 - 24928976
Alignment:
| Q |
75 |
cttttcatttgtttgcatatgtggtgcctttcattggattccattcactattactgcatatgctaccatgttttctgaagttcaatcaaatcccattgcc |
174 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| ||||| || | | ||||||||||||||||||||||||||| | |||||| ||||| || |
|
|
| T |
24929134 |
cttttcatttgtttgcatatgtggtgcttttcactggatcccatttaccgtcattgcatatgctaccatgttttctgaagtcccatcaaaccccatcacc |
24929035 |
T |
|
| Q |
175 |
tttgccatttcatttacatgtgcttacttgcttcatggtctcatactcacctctctcac |
233 |
Q |
| |
|
||||||||| ||||||| || ||||||||||| ||||| ||||||| | ||||||| |
|
|
| T |
24929034 |
tttgccattacatttaccatcgcctacttgcttcacggtctaatactcatcgctctcac |
24928976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University