View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12021_low_22 (Length: 207)
Name: NF12021_low_22
Description: NF12021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12021_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 155 - 188
Target Start/End: Original strand, 13023993 - 13024026
Alignment:
| Q |
155 |
cttaaaccataagtttcttgtatttgattagagt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13023993 |
cttaaaccataagtttcttgtatttgattagagt |
13024026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 13023855 - 13023887
Alignment:
| Q |
18 |
atgaacgagggagaagcacgatttcgatataac |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13023855 |
atgaacgagggagaagcacgatttcgatataac |
13023887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University