View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_102 (Length: 227)
Name: NF12023_high_102
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_102 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 22 - 158
Target Start/End: Original strand, 41222055 - 41222191
Alignment:
| Q |
22 |
atggatagatttctcatattcacttgacatatgagaatagagattctctcaattgaaatcctcattctttctaaattgttagttacatctcaaccataaa |
121 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41222055 |
atggatagatttctcatattcacgtgacatatgagaatagagattctctcaattgaaatcctcattctttctaaattgttagttacatctcaaccataaa |
41222154 |
T |
 |
| Q |
122 |
attcaatctctcaattgattcttttcgatgtagttcg |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41222155 |
attcaatctctcaattgattcttttcgatgtagttcg |
41222191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 158
Target Start/End: Original strand, 1293399 - 1293451
Alignment:
| Q |
107 |
catctcaaccataaaattcaatctctcaattgattctttt-cgatgtagttcg |
158 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | ||||||| | |||||||||| |
|
|
| T |
1293399 |
catctcaaccatcaaattcaatctctcaatcggttcttttacaatgtagttcg |
1293451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University