View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_108 (Length: 222)
Name: NF12023_high_108
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_108 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 45 - 203
Target Start/End: Complemental strand, 36934977 - 36934819
Alignment:
| Q |
45 |
ggagacggtggtagttactacgtttggtcgagttctcaaatgccagtgttagcctcaaccaacgttggtgctggtcgccttgtgcttaagcctcaaggct |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36934977 |
ggagacggtggtagttactacgtttggtcgagttctcaaatgccagtgttagcctcaaccaacgttggtgctggtcgccttgtgcttaagcctcaaggct |
36934878 |
T |
 |
| Q |
145 |
ttgctcttcctcattatgcagattcctctaaagttgcttatgtcattcaaggtcagtca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36934877 |
ttgctcttcctcattatgcagattcctctaaagttgcttatgtcattcaaggtcagtca |
36934819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 36935020 - 36934991
Alignment:
| Q |
1 |
tgtttgaaggagacggtggtagttttgttc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36935020 |
tgtttgaaggagacggtggtagttttgttc |
36934991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University