View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_38 (Length: 361)
Name: NF12023_high_38
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_38 |
 | |
|
| [»] scaffold1949 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 131 - 295
Target Start/End: Complemental strand, 37956288 - 37956125
Alignment:
| Q |
131 |
caaatttgtacaatatttgattcatgtaaatacaaatagtttttgaacttataattgagtttgaattagtgtggttttgccaacaaaattttttaggata |
230 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||| | ||| || |||| ||||| ||||| ||||||| || |||| ||||||||| |||||||||| |
|
|
| T |
37956288 |
caaatttgtacaatatttgagtcatataaacacaaacattttgtgtacttctaattaagttttaattagtttgatttt-ccaacaaaagcttttaggata |
37956190 |
T |
|
| Q |
231 |
ttatagaccacaaattatctacaaacggtaatttcttcagacaaatttcgtagtttgattatttc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37956189 |
atatagaccacaaattatctacaaacggtaacttcttcagacaaatttcgtagtttgattatttc |
37956125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 14 - 74
Target Start/End: Complemental strand, 37956405 - 37956345
Alignment:
| Q |
14 |
gaacagtataaagttaaaatataatgatggattgagatgcaaatatatggagattgagatg |
74 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37956405 |
gaacaatataaagttaaaatataatgatggattgagatgcaaatatatggagattgagatg |
37956345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1949 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold1949
Description:
Target: scaffold1949; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 155 - 113
Alignment:
| Q |
18 |
agtataaagttaaaatataatgatggattgagatgcaaatata |
60 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
155 |
agtataaagttaaaatataacaatggattgagattcaaatata |
113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University