View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_39 (Length: 361)
Name: NF12023_high_39
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 22 - 350
Target Start/End: Original strand, 1160696 - 1161025
Alignment:
| Q |
22 |
gaggtgaaggtaatgacttggaggtggatgcttagccgaaccacaactccggcgtgtatgttttatgagtggagttggagtccgcgggattgcttagcac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160696 |
gaggtgaaggtaatgacttggaggtggatgcttagccgaaccacaactccggcgtgtatgttttatgagtggagttggagtccgcgggattgcttagcac |
1160795 |
T |
 |
| Q |
122 |
gttaatgagttgctgcctccttttgnnnnnnnggtccagtggtgttg-ctgctcactggcagcgatgctgtcatgacagtccagcaagttttgttgtgtt |
220 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160796 |
gttaatgagctgctgcctccttttgtttttttggtccagtggtgttggctgctcactggcagcgatgctgtcatgacagtccagcaagttttgttgtgtc |
1160895 |
T |
 |
| Q |
221 |
gtgtagccggttttttgaggaaggtctggcctctttggtggcagctttgctggtctgttggaggcggtgctaaggggttgaattttgatggttcataatt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160896 |
gtgtagccggttttttgaggaaggtctggcctctttggtggcagctttgctggtctattggaggcggtgctaaggggttgaattttgatggttcataatt |
1160995 |
T |
 |
| Q |
321 |
ggatttcagagccatagctcaagcctctgt |
350 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |
|
|
| T |
1160996 |
ggatttcagagccataactcaagcctctgt |
1161025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 168 - 313
Target Start/End: Complemental strand, 21113901 - 21113756
Alignment:
| Q |
168 |
gctgctcactggcagcgatgctgtcatgacagtccagcaagttttgttgtgttgtgtagccggttttttgaggaaggtctggcctctttggtggcagctt |
267 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||| ||| |||||||||||||| ||||| ||||| |||||||| ||||| |||||| ||| |
|
|
| T |
21113901 |
gctgttcactggcagcgctgctgtcatgacagtccagcaccagttgctgtgttgtgtagcctgttttgtgaggtaggtctggggtcttttgtggcaactt |
21113802 |
T |
 |
| Q |
268 |
tgctggtctgttggaggcggtgctaaggggttgaattttgatggtt |
313 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
21113801 |
tgctgggctgttggaggcggtgctatggggttgaattttggtggtt |
21113756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 21977470 - 21977565
Alignment:
| Q |
21 |
agaggtgaaggtaatgacttggaggtggatgcttagccgaaccacaactccggcgtgtatgttttatgagtggagttggagtccgcgggattgctt |
116 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| || | ||||| |||||||| || ||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
21977470 |
agaggtgaaggtgatgtcttggaggtggattattggtagaacctcaactccgagttgcatgttctatgagtggagttggagtcctcgggattgctt |
21977565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 104
Target Start/End: Complemental strand, 4636711 - 4636666
Alignment:
| Q |
59 |
gaaccacaactccggcgtgtatgttttatgagtggagttggagtcc |
104 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||||||| |||| |
|
|
| T |
4636711 |
gaaccacaattccggcttgcatgttttatgagtggagttggtgtcc |
4636666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University