View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_62 (Length: 298)
Name: NF12023_high_62
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 132 - 274
Target Start/End: Complemental strand, 2409582 - 2409440
Alignment:
| Q |
132 |
tgcgtagccggggatcacaaaaccggctaaatggtaactcatttggatctcgagtttctgctctcatcttttccatgattgctaccatggccactattta |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409582 |
tgcgtagccggggatcacaaaaccggctaaatggtaactcatttggatctcgagtttctgctctcatcttttccatgattgctaccatggccactattta |
2409483 |
T |
|
| Q |
232 |
tgttgccggccggttagttacttctctgagttcttcttcatta |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409482 |
tgttgccggccggttagttacttctctgagttcttcttcatta |
2409440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 2409712 - 2409655
Alignment:
| Q |
19 |
tgcctctcaaacatcgatttcgtcctttaaaactctgtggatctgaaaatcagtgtga |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409712 |
tgcctctcaaacatcgatttcgtcctttaaaactctgtggatctgaaaatcagtgtga |
2409655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University