View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_76 (Length: 254)
Name: NF12023_high_76
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_76 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 15 - 254
Target Start/End: Complemental strand, 24605508 - 24605269
Alignment:
| Q |
15 |
atgaagcatcctctaaaatgtgttacatgcttttagatcactcatattaactatactatatattgtggtctgccactttattaaatgtaatctttaactt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24605508 |
atgaagcatcctctaaaatgtgttacatgcttttagatcactcatattaactatactatatattgtggtctgccactttattaaatgtaatctttaactt |
24605409 |
T |
 |
| Q |
115 |
ctacatagccaatcatgacccttattcctggtggatgtggaaagtttgtgaaccttatttccttcccttttccaacttggtcagcgcaaaaaggtccctt |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24605408 |
ctacatagccaatcatgactcttattcctggtggatgtggaaagtttgtgagccttatttccttcccttttccaacttggtcagcgcaaaaaggtccctt |
24605309 |
T |
 |
| Q |
215 |
atcacatgtttggttacttgagtcacaatgtcccttttct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24605308 |
atcacatgtttggttacttgagtcacaatgtcccttttct |
24605269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University