View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_83 (Length: 248)
Name: NF12023_high_83
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 46148144 - 46148358
Alignment:
| Q |
19 |
atagagttctttaacccctatccataaatccctttcgaccaacaatttttgatttaaagcagcaacattcttcgcagcttcttcaacaatcttatgcaac |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46148144 |
atagagttctttaacccctacccataaatccctttcgaccaacaatttttgatttaaagcagcaacattcttcgcaacttcttcaacaatcttatgcaac |
46148243 |
T |
|
| Q |
119 |
atgtcgttcataatatcgttcatcatctttatgctttcaaccgtgatatctaaatcaggatgcaccttcttcgcaactctatatatgtgcttttcaaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46148244 |
atgtcgttcataatatcgttcatcatctctatgctttcaaccgtgatatctaaatcaggatgcaccttcttcgcaactctatatatgtgctttttaaatt |
46148343 |
T |
|
| Q |
219 |
ctacagttcttctct |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46148344 |
ctacagttcttctct |
46148358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 66 - 196
Target Start/End: Complemental strand, 47046585 - 47046455
Alignment:
| Q |
66 |
tttgatttaaagcagcaacattcttcgcagcttcttcaacaatcttatgcaacatgtcgttcataatatcgttcatcatctttatgctttcaaccgtgat |
165 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| || |||||||||| ||||| || |||||| || ||||||||||| | |||| ||| |||||||| |
|
|
| T |
47046585 |
tttgattggaagcagcagcattcttcgcagcttcgtcgacaatcttatccaacacgttgttcattatctcgttcatcatatctatggcttccaccgtgat |
47046486 |
T |
|
| Q |
166 |
atctaaatcaggatgcaccttcttcgcaact |
196 |
Q |
| |
|
||||| ||||| | | ||| |||||||||| |
|
|
| T |
47046485 |
ttctaattcagggttctcctccttcgcaact |
47046455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University