View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_84 (Length: 247)
Name: NF12023_high_84
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_84 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 30040135 - 30039906
Alignment:
| Q |
18 |
gatattatgcattgcatgtaacatgtaacatgctagctaccaactagcaagaaacaaagtcaagtgtagaaagtctaggatgaagaggaagtagtgaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30040135 |
gatattatgcattgcatgtaacatgtaacatgctagctaccaactagcaagaaacaaagtcaagtgtagaaagtctaggatgaagaggaagtagtgaagg |
30040036 |
T |
 |
| Q |
118 |
acaaaaatgcaatgaggtttcataaagacaaaacaaaggaagacacttgtggttcctgctcaatttttgttgattatttttcctgtcttaattagaagct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30040035 |
acaaaaatgcaatgaggtttcataaagacaaaacaaaggaagacacttgtggttcctgctcaatttttgttgattatttttcctgtcttaattagaagct |
30039936 |
T |
 |
| Q |
218 |
aatccaattcaatactgttgcatatgccac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30039935 |
aatccaattcaatactgttgcatatgccac |
30039906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 59 - 125
Target Start/End: Complemental strand, 30029921 - 30029855
Alignment:
| Q |
59 |
aactagcaagaaacaaagtcaagtgtagaaagtctaggatgaagaggaagtagtgaaggacaaaaat |
125 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
30029921 |
aactagcaagaagcaaagtgaagtgtagaaagtttaggatgaagaggaagtaatgaaggaaaaaaat |
30029855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University