View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_90 (Length: 240)
Name: NF12023_high_90
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_90 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 13 - 139
Target Start/End: Original strand, 24660105 - 24660222
Alignment:
| Q |
13 |
caaaaataatacaatgaatattcaactatgatatctctaacacttaacggaagaattaaagacacatttatgtttaagatgaaccaatatttgttaattt |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
24660105 |
caaaaataatacaatgaatcttcaactatgatatctctaat-------ggaagaattaaagacacgtttatgtt--agatgaaccaatatttgttgattt |
24660195 |
T |
 |
| Q |
113 |
tcaacaaattcttttgggcacaaaggt |
139 |
Q |
| |
|
|||||||||| | ||||| |||||||| |
|
|
| T |
24660196 |
tcaacaaattttgttgggtacaaaggt |
24660222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 194
Target Start/End: Original strand, 24660273 - 24660313
Alignment:
| Q |
154 |
aagagacaaatttgtgataaaccatgaatgatctaatttgc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24660273 |
aagagacaaatttgtgataaaccatgaatgatgcaatttgc |
24660313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University