View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_high_98 (Length: 237)
Name: NF12023_high_98
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_high_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 33127273 - 33127106
Alignment:
| Q |
1 |
acttacttattgatatatgtagttttggtggtttagctcttttcaggaacaaccaatggaggtgaaagtgtttatacacaccatgctttcccctcaaaaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127273 |
acttgcttattgatatatgtagttttggtggtttagctcttttcaggaacaaccaatggaggtgaaagtgtttatacacaccatgctttcccctcaaaaa |
33127174 |
T |
 |
| Q |
101 |
gaaactaccaccactttaccttaattcaatattgtacacatgtcattatagctaaatataaaatcaat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127173 |
gaaactaccaccactttaccttaattcaatattgtacacatgtcattatagctaaatataaaatcaat |
33127106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 223
Target Start/End: Complemental strand, 33127108 - 33127068
Alignment:
| Q |
183 |
aattgatataaaccattgagtgtaaccgtacatgtacttca |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127108 |
aattgatataaaccattgagtgtaaccgtacatgtacttca |
33127068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University