View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_102 (Length: 237)
Name: NF12023_low_102
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_102 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 3745188 - 3744986
Alignment:
| Q |
19 |
tcaggttgatgggtttagatgctccagtgctacacgctttgcaccagatgatggatctttcagatgacaatgtggagaagacatcatcacacaatgctcc |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| | ||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3745188 |
tcaggttgatgggtttggatgctccagtgctacacgctcttcaccaaatgatggacctttcagatgacaatatggagaagacatcatcacacaatgctcc |
3745089 |
T |
|
| Q |
119 |
aactagatcctatgttagagatgccaaggcaatggctgctactcctgcagatattaaggaagatcagaattcatacgtgttcgtgattgacatgccagga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3745088 |
aactagatcctatgttagagatgccaaggcaatggctgctactcctgcagatattaaggaagatcagaattcatacgtgttcgtgattgacatgccagga |
3744989 |
T |
|
| Q |
219 |
ttg |
221 |
Q |
| |
|
||| |
|
|
| T |
3744988 |
ttg |
3744986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University