View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_103 (Length: 230)
Name: NF12023_low_103
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_103 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 20 - 178
Target Start/End: Original strand, 12570918 - 12571076
Alignment:
| Q |
20 |
tatccaacgacctagatttagcgcaacgaagggtacaagcgtaatgaatcaaagtagcatgaagtgtgcgagtttgaactttgaagattgataaataaaa |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12570918 |
tatccaacgacccagatttagcgcaacgaagggtacaagcgtaatgaatcaaagtagcatgaagtgtgcgagtttgaactttgaagattgataaataaaa |
12571017 |
T |
 |
| Q |
120 |
cagtgtttgggctttatcggagtgaatgagagttacattacagtaacgtgtgtttcgcg |
178 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
12571018 |
cagtgtttgggctttatcggagtgagtgagagttacattacacaaacgtgtgtttcgcg |
12571076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University