View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12023_low_113 (Length: 211)

Name: NF12023_low_113
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12023_low_113
NF12023_low_113
[»] chr3 (1 HSPs)
chr3 (1-194)||(48155270-48155458)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 48155270 - 48155458
Alignment:
1 attctatttttataaacaaaatgaaaatggaaaatggaaggaaatcatagtgcttgctcacatcgcgtaggcacatacttttcttggtagcagaaataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48155270 attctatttttataaacaaaatgaaaatggaaaatggaaggaaatcatagtgcttgctcacatcgcgtaggcacatacttttcttggtagcagaaataaa 48155369  T
101 ttttagttgagttttaatttgctccaaaaattaatcacgattaaggcaaatctcaaaaactcaaacagagtttacaaatatatttacatatata 194  Q
    | ||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48155370 tattagttgagt-----tttgctccaaaaattaatcacgattaaggcaaatctcaaaaactcaaacagagtttacaaatatatttacatatata 48155458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University